View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9489_high_2 (Length: 542)
Name: NF9489_high_2
Description: NF9489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9489_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-153; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 241 - 523
Target Start/End: Complemental strand, 39299171 - 39298889
Alignment:
| Q |
241 |
tggagaaagcagcacaagccaaagatgcaactcttgagaaaacacaacaaggttatgaagcaacaaaagacactgtttcaagcgctgcaaaaactgcaac |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299171 |
tggagaaagcagcacaagccaaagatgcaactgttgagaaaacacaacaaggttatgaagcaacaaaagacactgtttcaagcgctgcaaaaactgcaac |
39299072 |
T |
 |
| Q |
341 |
agaatatgctacccctgtggcggagaaagccaagtctgcagttgttcaggcaaaggatgttactgtagagacagggaagactgctgcggaagttgcaagc |
440 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299071 |
agaatatgttacccctgtggcggagaaagccaagtctgcagttgttcaggcaaaggatgttactgtagagacagggaagactgctgcggaagttgcaagc |
39298972 |
T |
 |
| Q |
441 |
aaagtggcggttgatttgaaggataaggccaccgtggcagggtggactgcggcacattattcgacgaagttgaccgtggatgg |
523 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298971 |
aaagtggcggttgatttgaaggataaggccaccgtggcagggtggactgcggcacattattcgacgaagttgaccgtggatgg |
39298889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 80 - 165
Target Start/End: Complemental strand, 39299332 - 39299247
Alignment:
| Q |
80 |
aatgtctttggaagagatagggaagtatagaaaccaagcacaacaaaatgaaatggacgcaatctcagcagcacaagagaggtatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299332 |
aatgtctttggaagagatagggaagtatagaaaccaagcacaacaaaatgaaatggacgcaatctcagcagcacaagagaggtatg |
39299247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 39299411 - 39299363
Alignment:
| Q |
1 |
cgggtgctggaaatgaaggtgcaatgttgggaaaaagtggtgctgaaca |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39299411 |
cgggtgctggaaatgaaggtgcaatgttgggaaaaagtgctgctgaaca |
39299363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University