View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9489_low_16 (Length: 292)
Name: NF9489_low_16
Description: NF9489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9489_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 7978845 - 7979112
Alignment:
| Q |
18 |
caccctgccccattcttcgtagtattttcctcattcaactagataaattggatttggattaggtgcaacaactacatcacgcagtactacatctgggccg |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||||||| | |
|
|
| T |
7978845 |
caccttgccccattcttcgtagtatttttctcattcaactagaaaaattggatttggattaggcgcaacaactacatcacacagtactacatctgggctg |
7978944 |
T |
|
| Q |
118 |
ctcgatctaagtcgagagatgagttcagttatttgtgtgaaacttaaatgtataatatgaactgtctagtattaaatcagtgacgaagatcgcttatagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||| |
|
|
| T |
7978945 |
ctcgatctaagtcgagagatgagttcagttatttgtgtgaaacttaaatgtataatatgaactgtctagtattaaatcggtggcaaagatcgcttatagc |
7979044 |
T |
|
| Q |
218 |
gtgaaactgtatgccacattaactataacacatcccaatc-aaaatatttaataccttgagaattatc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
7979045 |
gtgaaactgtatgccacattaactataacacatcccaatcaaaaatatttaataacttgagaattatc |
7979112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University