View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9489_low_17 (Length: 288)
Name: NF9489_low_17
Description: NF9489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9489_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 3811155 - 3810982
Alignment:
| Q |
1 |
ttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataacaaacccttttaagagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811155 |
ttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataacaaacccttttaagagt |
3811056 |
T |
 |
| Q |
101 |
aatgaatttgtggttaatcgtttaatttattgtctttattttctttttaagggtacctgttatgttccacattc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811055 |
aatgaatttgtggttaatcgtttaatttattgtttttattttctttttaagggtacctgttatgttccacattc |
3810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 270
Target Start/End: Complemental strand, 3810919 - 3810886
Alignment:
| Q |
237 |
cttgattcttgaagcgcataaatcaaattggagt |
270 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
3810919 |
cttgattcttgaagcgtataaatcaaattggagt |
3810886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University