View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9489_low_25 (Length: 225)
Name: NF9489_low_25
Description: NF9489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9489_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 141 - 215
Target Start/End: Original strand, 2061832 - 2061906
Alignment:
| Q |
141 |
cgacggtagtgtcgtgggtgcttgtaccatgccggaggtttggttggtttttgtgttgttcgtgttttgatgtcc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
2061832 |
cgacggtagtgtcgtgggtgcttgtaccatgccggaggtttggttggttttcgtgttgttcgtgttttgttgtcc |
2061906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 12 - 91
Target Start/End: Original strand, 2061703 - 2061782
Alignment:
| Q |
12 |
gtttcgtggtccgtcaattatctggtgctcgccggagttgtgcggttgttcgtgccacccctagtttggtaacctaactc |
91 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||| |||||| ||||||||| ||||||| ||| ||||| |
|
|
| T |
2061703 |
gtttcgtggttcgtcagttatctggtgctcgccggagttgtgcgattgttcacgccacccctggtttggtgaccgaactc |
2061782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University