View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9490_1 (Length: 362)
Name: NF9490_1
Description: NF9490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9490_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 110 - 349
Target Start/End: Complemental strand, 4264242 - 4264003
Alignment:
| Q |
110 |
gtgtacacttttgcatgcacaaatgaatgaattcataaaccatttctgggttttgcagattttccttcatggaagaagcttccacagtctactcttccat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4264242 |
gtgtacacttttgcatgcacaaatgaatgaattcataagccatttctgggttttgcagattttcctttatggaagaagcttccacagtctactcttccat |
4264143 |
T |
|
| Q |
210 |
tagtagctgatttcattataaaaaatggggttatatacacaagtgacgagtctctcccatttgcaaactccatggcagttgctaatggaagggttattcg |
309 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264142 |
tagtatctgatttcattataaaaaatggggttatatacacaagtgatgagtctctcccatttgcaaactccatggcagttgctaatggaagggttattcg |
4264043 |
T |
|
| Q |
310 |
tattggaaacttctcttttgtccaggttcatttcatttca |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264042 |
tattggaaacttctcttttgtccaggttcatttcatttca |
4264003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 4264349 - 4264275
Alignment:
| Q |
1 |
tagttatctccgcttcaatctctctacttctagccatactcattgcttctctccatcttctccaccccacatgta |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4264349 |
tagttatctccgcttcaatctctctacttctagccatactcattgcttctctccatcttctccaccccacatgta |
4264275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University