View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9491_low_12 (Length: 215)
Name: NF9491_low_12
Description: NF9491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9491_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 34257085 - 34257275
Alignment:
| Q |
10 |
gaagcagagagcaaggcttaaagttaggatccaacctctcaagatattgaaggaagacttcaatttacgatagttacagaaattcaagtcagaaaatgag |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34257085 |
gaagtagagagcaaggcttaaagttaggatccaacctctcaagatattgaaggaagacttcaatttacgatagttacataaattcaagtcagaaaatgag |
34257184 |
T |
|
| Q |
110 |
tataaccaatacacccaccacaacttatgcaaggtcactatcctccctagtaggggacaagacaaattatctttttaataatacaagtttt |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257185 |
tataaccaatacaaccaccacaacttatgcaaggtcactatcctccctagtaggggacaagacaaattatctttttaataatacaagtttt |
34257275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University