View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9491_low_8 (Length: 241)
Name: NF9491_low_8
Description: NF9491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9491_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 40 - 225
Target Start/End: Complemental strand, 56236241 - 56236061
Alignment:
| Q |
40 |
ctaacttttcttccttcattcatcggtctggctgtttttattgctcatagctaccgtttcaatttctccctacccctttcacacatggtccttcttcttg |
139 |
Q |
| |
|
||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56236241 |
ctaacttttctaccttcattaatcggtctcgctgtttttattgctcatagctaccgtatcaatttctccctacccctttcacacatggtccttcttcttg |
56236142 |
T |
|
| Q |
140 |
gataaattggctttatcatccttctttttagagttgtggctcgaaggataaagccaaattaaatcctttgaatccagggtcaatgg |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56236141 |
gata-----gctttatcatccttctttttagagctgtggctcgaaggataaagccaaattaaatcttttgaatccagggtcaatgg |
56236061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 40 - 225
Target Start/End: Complemental strand, 30518102 - 30517900
Alignment:
| Q |
40 |
ctaacttttcttccttcattcatcggtctggctgtttttattgctcatagctaccgtttcaatttctccctacccctttcacacatggtccttcttcttg |
139 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30518102 |
ctaacttttcttccttcattaatccgtctcactgtttttactgctcatagctaccgtttcaatttctccctacccctttcacacatggtccttcttcttg |
30518003 |
T |
|
| Q |
140 |
gataaattggct-----------------ttatcatccttctttttagagttgtggctcgaaggataaagccaaattaaatcctttgaatccagggtcaa |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30518002 |
gataaattggctttatgggtgtgatggctttatcatccttctttttagagttgtggctcgaaggataaagccaaattaaatcctttgaatccagggtcaa |
30517903 |
T |
|
| Q |
223 |
tgg |
225 |
Q |
| |
|
||| |
|
|
| T |
30517902 |
tgg |
30517900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 41 - 98
Target Start/End: Original strand, 2757903 - 2757960
Alignment:
| Q |
41 |
taacttttcttccttcattcatcggtctggctgtttttattgctcatagctaccgttt |
98 |
Q |
| |
|
|||||||||||| ||||||| || |||| ||| |||||| ||||||||||||||||| |
|
|
| T |
2757903 |
taacttttcttctttcattcctccgtctcgctatttttaccgctcatagctaccgttt |
2757960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University