View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9492_high_1 (Length: 383)
Name: NF9492_high_1
Description: NF9492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9492_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 9 - 364
Target Start/End: Original strand, 38087910 - 38088261
Alignment:
| Q |
9 |
aatcagatgatgtcaccgtggccacgacgagtttgcagcgaggccatggccatgaggcttgccacagcgagcctacaattgagtcacaacgaaacaagtc |
108 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
38087910 |
aatcagatgatgtcaccatggccacgacgagcctgcagcgaggccatggccatgaggctcgccacaacgagcctgcaatggagtcacaacgaaacaagtc |
38088009 |
T |
 |
| Q |
109 |
agagatcatggaaatcttgcaaaattgtgtgtggctgagcgagcctgggcgtcgccatggcgagcaaaggcggttttgacagctccaatgttgatgtggc |
208 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38088010 |
atagatcatggaaatcctgcaaaattgtgtgtggctaagcgatcctgggcgtcgccatggcgagcaaaggcggttttgacagctccaatgttgatgtggc |
38088109 |
T |
 |
| Q |
209 |
agaaacccacccatcgatgaagaaagcttcgctcaccacggcaagcctgggtgtgactaagttacggtgcaattttttagaaagtatataaacagcccca |
308 |
Q |
| |
|
||||| |||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
38088110 |
agaaatccac----tggtgaagaaagcttcgctcaccacggtgagcctgggtgtgactaagttacggtgcaatttttcagaaagtatataaatagcccca |
38088205 |
T |
 |
| Q |
309 |
aacctcagaacaagtggaattatgtcattgttagggagaggaaaacaaagaaacat |
364 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
38088206 |
aacctcagaacaagtggaattatgtcatttttagggagaggaaaacagagaaacat |
38088261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 14514726 - 14514779
Alignment:
| Q |
168 |
gcgagcaaaggcggttttgacagctccaatgttgatgtggcagaaacccaccca |
221 |
Q |
| |
|
|||||| |||||||||||||||||| || || || ||||||||||||||||||| |
|
|
| T |
14514726 |
gcgagctaaggcggttttgacagcttcagtgctggtgtggcagaaacccaccca |
14514779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 327 - 364
Target Start/End: Complemental strand, 1217184 - 1217147
Alignment:
| Q |
327 |
attatgtcattgttagggagaggaaaacaaagaaacat |
364 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
1217184 |
attatgtcattttttgggagaggaaaacaaagaaacat |
1217147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University