View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9493_8 (Length: 304)
Name: NF9493_8
Description: NF9493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9493_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 23 - 143
Target Start/End: Complemental strand, 49908796 - 49908681
Alignment:
| Q |
23 |
acaattgtacaagtggtggtggagaatgggactctggctgaaagggtggcaaacggcatgagagacaattctctccaaccccaccacaccacatatgaat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
49908796 |
acaattgtacaagtggtggtggagaatgggactctggctgaaagggtggcaaacggcatgagacacaattctctccaaccccac-----cacatatgaat |
49908702 |
T |
|
| Q |
123 |
tcactaaagacaaccatacac |
143 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49908701 |
tcactaaagacaaccatacac |
49908681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 217 - 304
Target Start/End: Complemental strand, 49908607 - 49908519
Alignment:
| Q |
217 |
ggcactaagatgacggggata-gggcatttaggatggataatttgtcttggcatgaatatgtgacttttgtaggatggatgaagttaat |
304 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49908607 |
ggcactaagatgacggggataagggcatttaggatggataatttgtcttggcatgaatatgtgacttttgtaggatggatgaagttaat |
49908519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University