View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9493_high_1 (Length: 216)
Name: NF9493_high_1
Description: NF9493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9493_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 80 - 200
Target Start/End: Original strand, 49908681 - 49908796
Alignment:
| Q |
80 |
gtgtatggttgtctttagtgaattcatatgtggtgtggtggggttggagagaattgtctctcatgccgtttgccaccctttcagccagagtcccattctc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49908681 |
gtgtatggttgtctttagtgaattcatatgtg-----gtggggttggagagaattgtgtctcatgccgtttgccaccctttcagccagagtcccattctc |
49908775 |
T |
 |
| Q |
180 |
caccaccacttgtacaattgt |
200 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49908776 |
caccaccacttgtacaattgt |
49908796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University