View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9493_low_3 (Length: 216)

Name: NF9493_low_3
Description: NF9493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9493_low_3
NF9493_low_3
[»] chr1 (1 HSPs)
chr1 (80-200)||(49908681-49908796)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 80 - 200
Target Start/End: Original strand, 49908681 - 49908796
Alignment:
80 gtgtatggttgtctttagtgaattcatatgtggtgtggtggggttggagagaattgtctctcatgccgtttgccaccctttcagccagagtcccattctc 179  Q
    ||||||||||||||||||||||||||||||||     |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
49908681 gtgtatggttgtctttagtgaattcatatgtg-----gtggggttggagagaattgtgtctcatgccgtttgccaccctttcagccagagtcccattctc 49908775  T
180 caccaccacttgtacaattgt 200  Q
    |||||||||||||||||||||    
49908776 caccaccacttgtacaattgt 49908796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University