View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9494_low_3 (Length: 294)
Name: NF9494_low_3
Description: NF9494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9494_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 14 - 279
Target Start/End: Original strand, 27372527 - 27372792
Alignment:
| Q |
14 |
aggaatcatatttttcaatcactagatacaacaaaatggtcaaccactctttgtcacaatggaaaaaatatttggatactaaaaatggtttctaaaatta |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27372527 |
aggaatgatatttttcaatcactagatacaacaaaatggtcaaccactctttgtcacaatggaaaaaatatttggatactaaaaatggttactaaaatta |
27372626 |
T |
|
| Q |
114 |
tgcattttgtttttcaaagacagagtaggtgtcatggtgtgaatcacagtgtctcaatcatacaatgtagaaggtttcttgggtgtttcttgagagacat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27372627 |
tgcattttgtttttcaaagacagagtaggtgtcatggtgtgaatcacagtgtctcaatcatacaatgtagaaggtttcttgggagtttcttgagagacat |
27372726 |
T |
|
| Q |
214 |
gttgttgaagttttacaaacaaaaacaagacgatcctcttaaggatattttttggatgggtcgagg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27372727 |
gttgttgaagttttacaaacaaaaacaagacgatcctcttaaggatattttttggatggatcgagg |
27372792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 203 - 265
Target Start/End: Complemental strand, 30989590 - 30989528
Alignment:
| Q |
203 |
ttgagagacatgttgttgaagttttacaaacaaaaacaagacgatcctcttaaggatattttt |
265 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
30989590 |
ttgagggacatgttgctaaagttttacaaacaaaacgaagaagatcctcctaaggatattttt |
30989528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University