View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9497_low_10 (Length: 239)
Name: NF9497_low_10
Description: NF9497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9497_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 234
Target Start/End: Complemental strand, 40509213 - 40509002
Alignment:
| Q |
21 |
cctaggattctagcgcaaatggttgattcgtttcgtttgtgattattgtaaacctcgagatactgaatttgattgtatatattttgaagtaatccagttt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40509213 |
cctaggattctagcgcaaatggttgattcgtttcgtttgtgattattgtaaacctcgagatactgaatttgattgtatatatt--gaagtaatccagttt |
40509116 |
T |
 |
| Q |
121 |
ccaaacacaacaaaatcaaaattatcccattacatgataacaagcaaatgagtatcccaatttaatttaatcaaaaatcaaaactaaccctgccaaacca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40509115 |
ccaaacacaacaaaatcaaaattatcccattacatgataacaagcaaatgagtgtctcaatttaatttaatcaaaaaccaaaactaaccctgccaaacca |
40509016 |
T |
 |
| Q |
221 |
ctaagtataatcta |
234 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
40509015 |
ctaaatataatcta |
40509002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University