View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9498_low_5 (Length: 282)
Name: NF9498_low_5
Description: NF9498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9498_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 16 - 276
Target Start/End: Original strand, 41563513 - 41563773
Alignment:
| Q |
16 |
attaacacatcaaaaacaaaacatcatcgttaccattgtcacaactccacacaacgcttctcgtttttcacaaactttttctcaaaattcacaaatccaa |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41563513 |
attagcacatcaaaaacaaaacatcatcgttaccattgtcacaactccacacaacgcttctcgtttttcacaaactttttctcaaaattcacaaatccaa |
41563612 |
T |
|
| Q |
116 |
ttacttcaacttcaattcccttctaaagatgctggatttccagaaggatgtgagaattttgacatgcttccatcaatgtccatggctcatactttcttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41563613 |
ttacttcaacttcaattcccttctaaagatgctggatttccagaaggatgtgagaattttgacatgcttccatcaatgtctatggctcatactttcttca |
41563712 |
T |
|
| Q |
216 |
aagtagcaaatacccttctacaagatcaagcagaagaagcttttgaaaagttaacaccaaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41563713 |
aagtagcaaatacccttctacaagatcaagcagaagaagcttttgaaaagttaacaccaaa |
41563773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University