View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9499_high_9 (Length: 256)
Name: NF9499_high_9
Description: NF9499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9499_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 4 - 239
Target Start/End: Complemental strand, 11055568 - 11055336
Alignment:
| Q |
4 |
tttttagaaaatcatgatcggagtgattctaaaatattcactctaatatcaaacatacatcatatattttttaaaa-caatttggtgtttccattaactt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11055568 |
tttttagaaaatcatgatcggagtgattctgaaatatccactctgatatcaaacatacatcgtatattttttaaaaacaatttggtgtttctattaactt |
11055469 |
T |
|
| Q |
103 |
gtgatcgggtaagacatgacatgttaactcaatatgtggcattttatatcaatgacacatcagcacacaaaacattttgtacgaaattaatgattttatt |
202 |
Q |
| |
|
||||| || || ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11055468 |
gtgatgggatatgacatgacatgttaacttaatatgtggcattttatatccatgacacatcagcacacaaaacattttgtacgaaattaatga--ttatt |
11055371 |
T |
|
| Q |
203 |
tgaaatgatcattttgaaaaaagaaaatagaatttac |
239 |
Q |
| |
|
|| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
11055370 |
tggaatgatcatttt--aaaaaaaaaatagaatttac |
11055336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University