View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9499_low_13 (Length: 413)
Name: NF9499_low_13
Description: NF9499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9499_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 19 - 123
Target Start/End: Complemental strand, 19044736 - 19044632
Alignment:
| Q |
19 |
gttgcggtattctgtatatatgcggtgccgtatgtattatatttgattcccttccgcagtcttttgcaccttgcatattccgatgagaataaaatttgcc |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||| | |
|
|
| T |
19044736 |
gttgcggtattccgtatatatgcggtgccgtatgtattatatttgattcccttccgcggtcttttgcaccttgcgtattccgacgagaataaaatttgtc |
19044637 |
T |
|
| Q |
119 |
aattc |
123 |
Q |
| |
|
||||| |
|
|
| T |
19044636 |
aattc |
19044632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 241 - 398
Target Start/End: Original strand, 37736535 - 37736692
Alignment:
| Q |
241 |
ttgttgttacagaccacaagcattgatgtcttcgacagaagaatgcatgatgatttgaatttcaaattcctggataatacagctggaaaaccatggtaat |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||| || | |||| ||||||||| ||||| |||||||||||||||| | | |
|
|
| T |
37736535 |
ttgttgttacagaccacaagcattgatgtcttcgatagaagaaggcatgacgaacttgattttgaattcctgggtaataaagctggaaaaccatggcagt |
37736634 |
T |
|
| Q |
341 |
tccaaacaaacttgtttggagatggaaccaatggtcgtgatgaacgttaccatctctg |
398 |
Q |
| |
|
|||||||||||||||||||| ||||||| | ||||||||| || |||||| ||||||| |
|
|
| T |
37736635 |
tccaaacaaacttgtttggaaatggaactagtggtcgtgaggagcgttacgatctctg |
37736692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University