View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9499_low_20 (Length: 333)
Name: NF9499_low_20
Description: NF9499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9499_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 20 - 325
Target Start/End: Complemental strand, 11698556 - 11698251
Alignment:
| Q |
20 |
acttgatcgcctcagcaagnnnnnnntcaacctcttaggcttaagggacaccataaaacacaactgtttttgcaataacaaacttaccatgatttttacg |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11698556 |
acttgatcgcctcagcaagccccccctcaacctcttaggcttaagggacaccataaaacacaactgtttttgcaataacaaacttaccatgatttttacg |
11698457 |
T |
|
| Q |
120 |
gatgcacataccaattccaaatatgttctggttagtaaccactgcagcgtccacattgcatttcaacttaccggcatttggtttgcttcatcggggaact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11698456 |
gatgcacataccaattccaaatatgttctggttagtaaccactgcagcgtccacattgcatttcaacttaccggcatttggtttgcttcatcggggaact |
11698357 |
T |
|
| Q |
220 |
tcctcctgcctagactcaccgcggttccctgtcctggactggcagacctgttgccaattatgcaggaaatctcgcgccagcatgaaagacacagccggcc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11698356 |
tcctcctgcctagactcaccgcggttccctgtcctggactggcagacctgttgccaattatgcaggaaatctcgcgccagcatgaaagacacagccggcc |
11698257 |
T |
|
| Q |
320 |
tttgct |
325 |
Q |
| |
|
|||||| |
|
|
| T |
11698256 |
tttgct |
11698251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University