View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9499_low_39 (Length: 213)
Name: NF9499_low_39
Description: NF9499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9499_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 14130925 - 14130823
Alignment:
| Q |
18 |
atatgcagagagggaaggggc----agagctaagattaaaggattaaggagctaactatgataattaaaattcatcttaaaatatggaggtggtgatgag |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14130925 |
atatgcagagagggaaggggccagcagagctaagattaaaggattaaggagctaactatgataattaaaattcattttaaaatatggaggtggtgatgag |
14130826 |
T |
 |
| Q |
114 |
att |
116 |
Q |
| |
|
||| |
|
|
| T |
14130825 |
att |
14130823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University