View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9499_low_9 (Length: 435)
Name: NF9499_low_9
Description: NF9499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9499_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 25129325 - 25129045
Alignment:
| Q |
19 |
tgtgtgtggacgaagaagctggttcattgaagtgaagggaagcttagtggtgtttgttcaattcaactcaactgcgagtttgttagttagagcttagaat |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25129325 |
tgtgtgtggacgaagaaggtggttcattgaagtgaagggaagcttagtggtgtttgttcaattcaactcaactgcgagtttgttagttagagcttagaat |
25129226 |
T |
|
| Q |
119 |
ggttgttggcttcggaatgagaactcaactcaactaactgctggtagttagttcagttaggatttggaattgggaacgtagccgttgatttcagatcaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
25129225 |
ggttgttggcttcggaatgagaactcaactcaactaactgctggtagttagttcagttaggatttggaattgtgaacgtagcagttgatttcagatcaga |
25129126 |
T |
|
| Q |
219 |
tggttcatattttaaacttgatttcatatagt-aaataatctcaaccgccaatttatgatcaaacgtctcatatcaactac |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25129125 |
tggttcatattttaaacttgatttcatatagtaaaacaatctcaaccgccagtttatgatcaaacgtctcatatcaactac |
25129045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 321 - 361
Target Start/End: Complemental strand, 25129056 - 25129016
Alignment:
| Q |
321 |
catatcaactactttctattcaagacgaattaaccccctca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25129056 |
catatcaactactttctattcaagacgaattaaccccctca |
25129016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University