View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9500_low_1 (Length: 403)
Name: NF9500_low_1
Description: NF9500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9500_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Original strand, 52724742 - 52725130
Alignment:
| Q |
1 |
ccaccatcatcaccaccttctctgagcccaagctcgaaaccgtgatagacctctcaatcttcccttcctttcattccaatattcgtcaattcgtttcatc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52724742 |
ccaccaccatcaccaccttctctgagcccaagctcgaaaccgtcatagacctctcaatcttcccttcctttcattccaatattcgtcaattcgtttcatc |
52724841 |
T |
 |
| Q |
101 |
tggtaaagaggcataccgcgatttacagaccctattcactattgaccataaccgaagagtcatcatttcatgtcgcccttcaaccttgcacttcgtagga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52724842 |
tggtaaagaggcataccgcgatttacagaccctattcactattgaccataaccgaagagtcatcatttcatgtcgcccttccaccttgcacttcgtagga |
52724941 |
T |
 |
| Q |
201 |
acttcagctgctttgaccctcatcgctttttctgttttgagggtattctttgaattggtttctaggtatgcgtcgtggagtagtcgaaacgcatctagct |
300 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
52724942 |
acttcagctgctttgactctcatcgctttttctgttttgagggtattctttgaattggtttctaggtttgcgtcgtggagtagtcgaaacccatctagct |
52725041 |
T |
 |
| Q |
301 |
acaataataacaataagggtattatggtgcggagagaccggagtcttggtggaaaagaggtggttattggattgagtcccattcacagcacaacccct |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52725042 |
---------acaataagggtattatggtgcggagagaccggagtcttggtggaaaagaggtggttattggattgagtcccattcacagcacaacccct |
52725130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University