View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9500_low_10 (Length: 245)
Name: NF9500_low_10
Description: NF9500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9500_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 228
Target Start/End: Complemental strand, 40260625 - 40260413
Alignment:
| Q |
16 |
ttggagttacaggttgagagtgaaaggcgaagactaatagaactgaaactggaagctgagcaagaaagacgacggatcatggaagaaatgttgctttctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40260625 |
ttggagttacaggttgagagtgaaaggcgaagactaatagaactgaaactggaagctgagcaagaaagacgacggatcatggaagaaacgttgctttctt |
40260526 |
T |
 |
| Q |
116 |
tctttcataaaatgcttggaagggtccctcaacaattttcttaccttctttctcaaactcgattggtacttgtcctcaannnnnnnacatttactaatca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40260525 |
tctttcataaaatgcttggaagggtccctcaacaattttcttaccttctttctcaaactcgattggtacttgtcctcaatttttttacatttactaatca |
40260426 |
T |
 |
| Q |
216 |
attttgaagtaga |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40260425 |
attttgaagtaga |
40260413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University