View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9500_low_6 (Length: 330)
Name: NF9500_low_6
Description: NF9500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9500_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 7e-37; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 229 - 311
Target Start/End: Complemental strand, 6384176 - 6384094
Alignment:
| Q |
229 |
catgcgtgggatgcatggacgagagaatttttctccttgttctcttcatttttcatgtacttttcatcattgatatgaacttg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6384176 |
catgcgtgggatgcatggacgagagaatttttctccttgttctcttcatttttcatgtatttttcatcattgatatgaacttg |
6384094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 15 - 122
Target Start/End: Complemental strand, 6379239 - 6379130
Alignment:
| Q |
15 |
agagaaataaaa-tgtgcatacacaataacaagcgaaaggggttagaaaaa-acctattttggttgctttggtcacactccttagcctccgagctgtcat |
112 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||||||||| |||||| ||| ||||||||||| | |||||||| |||||||| ||| ||||| |
|
|
| T |
6379239 |
agagaaataaaagtgtatatacacaataacaagttaaaggggtttgaaaaacaccccttttggttgctctagtcacacttcttagcctatgagtcgtcat |
6379140 |
T |
|
| Q |
113 |
gattttgaat |
122 |
Q |
| |
|
|||| ||||| |
|
|
| T |
6379139 |
gattctgaat |
6379130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 311
Target Start/End: Complemental strand, 23736985 - 23736947
Alignment:
| Q |
273 |
ttcatttttcatgtacttttcatcattgatatgaacttg |
311 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23736985 |
ttcatttttcatgtgcttttcatctttgatatgaacttg |
23736947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University