View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9501_low_16 (Length: 322)
Name: NF9501_low_16
Description: NF9501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9501_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 7005368 - 7005065
Alignment:
| Q |
1 |
caagtatgaaattaaataagataggtaagtgttaatttcttgggggagggaacaaaaattcaagcaaatctcttcaactgacactcttatccctttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7005368 |
caagtatgaaattaaataagataggtaagtgttaatttcttgggcgagggaacaaaaattcaagcaaatctcttcaactgacactcttatccctttgttg |
7005269 |
T |
|
| Q |
101 |
tgtagctgaaaataggtttctgtttcaacctttgcatgggaccaatccttttaattagtattacatcaataattttcattagcattgtttaattattgtt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || | |
|
|
| T |
7005268 |
tgtagctgaaaataggtttctatttcaacctttgcatgggaccaatccttttaattagtattgcatcaataattttcattagcattgtttaattactgct |
7005169 |
T |
|
| Q |
201 |
atagattttgtttagaattaattcacaatggcaaagtagataagtaaaatgtgtacataagataaggggtggtagggagaaagatggggcttatcatgct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7005168 |
atagattttgtttagaattaattcacaatggcaaagtagataagcaaaatgtgtacataagataaggggtggtagggagaaagatggggcttatcatgct |
7005069 |
T |
|
| Q |
301 |
tgat |
304 |
Q |
| |
|
|||| |
|
|
| T |
7005068 |
tgat |
7005065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University