View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9501_low_32 (Length: 246)
Name: NF9501_low_32
Description: NF9501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9501_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 26 - 143
Target Start/End: Complemental strand, 38089168 - 38089050
Alignment:
| Q |
26 |
ttcaagaggcgcatctgtt-aagtataattcaaagtttaacataaaggtctgcttacctagtcattccaataataagataataaatttaggcttatgatt |
124 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38089168 |
ttcaagaggcgcatctgttgaagtataattcaaagtttaacataaaggtctgcttacctagtcattccaataataagataataattttaggcttatgatt |
38089069 |
T |
|
| Q |
125 |
gttacgagagcaattttaa |
143 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38089068 |
gttacgagagcaattttaa |
38089050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 143 - 232
Target Start/End: Complemental strand, 38089004 - 38088915
Alignment:
| Q |
143 |
atataggattctcaaacaagggatatttgaaaagaaacaaaaaatagttttaggaagccaaattagcccctactactttatgaacctatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38089004 |
atataggattctcaaacaagggatatttgaaaagaaacaaaaaatagttttaggaagccaaattagcccctactactttatgaacctatg |
38088915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University