View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9501_low_7 (Length: 459)
Name: NF9501_low_7
Description: NF9501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9501_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 233
Target Start/End: Complemental strand, 48762625 - 48762398
Alignment:
| Q |
8 |
cacagactagtcttagagaaatcatattttgaaattatttcttcacccaaaaccttgaatcgagggttttgaagggaagatggtttttgagaacttaaaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48762625 |
cacacactagtcttagagaaatcatattttgaaattatttcttcacccaaaaccttgaattgagggttttgaagggaagatggtttttgagaacttaaaa |
48762526 |
T |
 |
| Q |
108 |
tatattttcaaaatcatttatttatttatttctcaaattttccattgatgtaacgtgcaaaagcacaagagagatgtagaagaaaaacggaat--gagaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48762525 |
tatattttcaaaatcatttatttatttatttctcaaattttctattgatgtaacttgcaaaagcacaagagagatgtagaagaaaaacggaattcgagaa |
48762426 |
T |
 |
| Q |
206 |
ccctttagatttctaaggatcaatccac |
233 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
48762425 |
ccctttagatttctaaggattaatccac |
48762398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University