View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9503_high_1 (Length: 235)
Name: NF9503_high_1
Description: NF9503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9503_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 40223913 - 40223708
Alignment:
| Q |
18 |
acctaaatgtgttttagtgatttagagtttggccacaacatatgtaaagttccatcaataattatttagcaatgaatcaaacttaagttcatgatttgtc |
117 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| ||||| |||||||||||| |||||||||||||| |||| |||||||||||||||||||||||| || |
|
|
| T |
40223913 |
acctaaatgtgtttcagtaatttagagtttggcgacaacgtatgtaaagttcgatcaataattattttgcaacgaatcaaacttaagttcatgatttatc |
40223814 |
T |
 |
| Q |
118 |
ttttggtgaagttgattaaccatgtgagtccaatcccttaatttatataatcttgagtttgttgagtgatgctttcacacattattcaatttttctgtgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
40223813 |
ttttggtgaagttgattaaccatgtgagtccaatcccttgatttatataatcttgagtttgttgagtgatgctttcacacgttattcaatttttttgtgt |
40223714 |
T |
 |
| Q |
218 |
cctttg |
223 |
Q |
| |
|
|||||| |
|
|
| T |
40223713 |
cctttg |
40223708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University