View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_high_7 (Length: 464)
Name: NF9504_high_7
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_high_7 |
 |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 357; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 19 - 453
Target Start/End: Complemental strand, 9627009 - 9626564
Alignment:
| Q |
19 |
atgttgatatccgacactgacacatgtgtacattcaattatgtcatttttcaaattattatcagtgtc-------------tgtgtcacattcatgtttg |
105 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
9627009 |
atgttgatatccgacaccgacacatgtgtacattcaattatgtcatttttcaaattattatcagtgtcgacgttcggtgtctgtgtcacattcgtgtttg |
9626910 |
T |
 |
| Q |
106 |
tgtgtgtgcttcatagtcactaactgcatctaattaatttaatatctcaatcaaattattatgaaagatgatgtgtcaatgtcgtgtctaatggttgtat |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9626909 |
tgtgtg--cttcatagtcactaactgcatctaattaatttagtatctcaatcaaattattatgaaagatgatgtgtcaatgtcgtgtctaatggttgtat |
9626812 |
T |
 |
| Q |
206 |
caatgtcggtgtttcatagaatgtcactaatttttcattcccctttatattatcccttagattgtatcaatagatggaaaattctggacatgccattgac |
305 |
Q |
| |
|
||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9626811 |
caatgtcggtgcttcatagaatgtcgctgatttttcattcccctttatattatcccttagattgtatcaatagatggaaaattctggacatgccattgac |
9626712 |
T |
 |
| Q |
306 |
aagaaccagtggttgtgtttgtcacttgacattgcttatttgtgggccagtttctccatatttctggagaggatttatctatgagctgaaatggtgacca |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9626711 |
aagaaccagtggttgtgtttgtcacttgactttgcttatttgtgggccagtttctccatatttctggagaggatttatttatgagctgaaatggtgacca |
9626612 |
T |
 |
| Q |
406 |
ccgaccacaagctcttcaactttttctccttcttcatagctgagtatt |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9626611 |
ccgaccacaagctcttcaactttttctccttcttcatagctgaatatt |
9626564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 47 - 78
Target Start/End: Complemental strand, 44605452 - 44605421
Alignment:
| Q |
47 |
tacattcaattatgtcatttttcaaattatta |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44605452 |
tacattcaattatgtcatttttcaaattatta |
44605421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 54 - 86
Target Start/End: Complemental strand, 12052268 - 12052236
Alignment:
| Q |
54 |
aattatgtcatttttcaaattattatcagtgtc |
86 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12052268 |
aattatgtcaattttcaaattattatcagtgtc |
12052236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 56; Significance: 5e-23; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 128 - 227
Target Start/End: Complemental strand, 50581 - 50482
Alignment:
| Q |
128 |
actgcatctaattaatttaatatctcaatcaaattattatgaaagatgatgtgtcaatgtcgtgtctaatggttgtatcaatgtcggtgtttcatagaat |
227 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| || ||||||||||| |||| |||||||| ||||||| |||| ||| ||||||||| |
|
|
| T |
50581 |
actgcatctaattaatttagtatctcaatcaaattattatgagtgacgatgtgtcaatatcgtatctaatggctgtatcagtgtcagtgcatcatagaat |
50482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 140 - 227
Target Start/End: Complemental strand, 29970 - 29883
Alignment:
| Q |
140 |
taatttaatatctcaatcaaattattatgaaagatgatgtgtcaatgtcgtgtctaatggttgtatcaatgtcggtgtttcatagaat |
227 |
Q |
| |
|
||||||| |||||||||||| ||||||| | |||||||||||||| || |||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
29970 |
taatttagtatctcaatcaagttattattagggatgatgtgtcaatatcatgtctaatggttgtatcagtgtcagtgcttcatagaat |
29883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 37 - 86
Target Start/End: Complemental strand, 30098 - 30049
Alignment:
| Q |
37 |
gacacatgtgtacattcaattatgtcatttttcaaattattatcagtgtc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30098 |
gacacatgtgtacattcaattatgtcatttttcaaactattatcagtgtc |
30049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 26 - 86
Target Start/End: Complemental strand, 50704 - 50645
Alignment:
| Q |
26 |
tatccgacactgacacatgtgtacattcaattatgtcatttttcaaattattatcagtgtc |
86 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50704 |
tatctgacaccgacacatgtgagcattcaattatgtca-ttttcaaattattatcagtgtc |
50645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 49 - 86
Target Start/End: Complemental strand, 5307098 - 5307061
Alignment:
| Q |
49 |
cattcaattatgtcatttttcaaattattatcagtgtc |
86 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5307098 |
cattgaattatgtcatttttcaaattattatcagtgtc |
5307061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 92
Target Start/End: Original strand, 18513243 - 18513306
Alignment:
| Q |
32 |
acactgacacatgtg--tacattcaattatgtcatttt-tcaaattattatcagtgtctgtgtc |
92 |
Q |
| |
|
|||||||||||| || |||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
18513243 |
acactgacacatatgattacattgaattatgtcattttctcaaattattatcggtgtctgtgtc |
18513306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 43188650 - 43188607
Alignment:
| Q |
49 |
cattcaattatgtcatttt-tcaaattattatcagtgtctgtgt |
91 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43188650 |
cattgaattatgtcattttctcaaattattatcagtgtctgtgt |
43188607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 54 - 91
Target Start/End: Original strand, 25950570 - 25950607
Alignment:
| Q |
54 |
aattatgtcatttttcaaattattatcagtgtctgtgt |
91 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
25950570 |
aattatgtcatttttcaaattattatcggtgtcggtgt |
25950607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 47 - 86
Target Start/End: Original strand, 5654610 - 5654650
Alignment:
| Q |
47 |
tacattcaattatgtcatttt-tcaaattattatcagtgtc |
86 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
5654610 |
tacattgaattatgtcattttctcaaattattatcagtgtc |
5654650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 31 - 79
Target Start/End: Original strand, 34547207 - 34547257
Alignment:
| Q |
31 |
gacactgacacatgtg--tacattcaattatgtcatttttcaaattattat |
79 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
34547207 |
gacactcacacatgtgattacattaaattatgtcatttttcaaattattat |
34547257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 47 - 79
Target Start/End: Original strand, 13815058 - 13815090
Alignment:
| Q |
47 |
tacattcaattatgtcatttttcaaattattat |
79 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
13815058 |
tacattcaattatgtcattttttaaattattat |
13815090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 47 - 81
Target Start/End: Original strand, 498416 - 498450
Alignment:
| Q |
47 |
tacattcaattatgtcatttttcaaattattatca |
81 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
498416 |
tacattgaattatgtcatttttcaaattattatca |
498450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 37 - 74
Target Start/End: Complemental strand, 6824269 - 6824230
Alignment:
| Q |
37 |
gacacatgtg--tacattcaattatgtcatttttcaaatt |
74 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6824269 |
gacacatgtgattacattcaattatgtcatttttcaaatt |
6824230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 26870490 - 26870542
Alignment:
| Q |
36 |
tgacacatgtgtacattcaattatgtca-tttttcaaattattatcagtgtct |
87 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
26870490 |
tgacacatgattacattcaattaagtcaatttttcaaataattatcagtgtct |
26870542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 19323448 - 19323507
Alignment:
| Q |
30 |
cgacactgacacatgtg--tacattcaattatgtcatttt-tcaaattattatcagtgtc |
86 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
19323448 |
cgacacttacacatgtgattaaattcaattatgtcattttctcaaattactatcagtgtc |
19323507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 47 - 86
Target Start/End: Original strand, 32166202 - 32166242
Alignment:
| Q |
47 |
tacattcaattatgtcatttt-tcaaattattatcagtgtc |
86 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
32166202 |
tacattcaattatgtcattttctcaaattattaccagtgtc |
32166242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 35990525 - 35990584
Alignment:
| Q |
30 |
cgacactgacacatgtg--tacattcaattatgtcatttt-tcaaattattatcagtgtc |
86 |
Q |
| |
|
||||||||||||||||| |||||||| |||| | ||||| ||||||||||||||||||| |
|
|
| T |
35990525 |
cgacactgacacatgtggttacattcagttattttattttctcaaattattatcagtgtc |
35990584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University