View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_41 (Length: 335)
Name: NF9504_low_41
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 25 - 330
Target Start/End: Complemental strand, 35576651 - 35576346
Alignment:
| Q |
25 |
accaccaccaccataacataaccacatctctctcaatttcataatcacttcttcaccgcgatttctaaacgcgattatcgttatttctctgttcacacga |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35576651 |
accaccaccaccataacataaccacatctctctcaatttcataatcacttcttcaccgcgatttctaaacgcgattatcgttatttctctattcacacga |
35576552 |
T |
 |
| Q |
125 |
ttaattaacgttaaaacgattaatcaatctatcaaattatcttggaatcgattattgttatgggcgagttgactcaaacggaggtgtactcgccaccacg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35576551 |
ttaattaacgttaaaacgattaatcaatctatcaaattatcttggaatcgattattgttatgggcgagttgactcaaacggaggtgtactcgccaccacg |
35576452 |
T |
 |
| Q |
225 |
aactcaacaagtttggaaatcacttttaagttggttcgcttttttctttcagatcttctctcagattattcgaacccttggtcactatcctttactctct |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35576451 |
aactcaacaagtttggaaatcacttttaagttggttcgcttttttctttcagatcttctctcagattattcgaacccttggtcactatcctttactctct |
35576352 |
T |
 |
| Q |
325 |
gcttct |
330 |
Q |
| |
|
||||| |
|
|
| T |
35576351 |
tcttct |
35576346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University