View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_46 (Length: 313)
Name: NF9504_low_46
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 19 - 302
Target Start/End: Complemental strand, 33512687 - 33512405
Alignment:
| Q |
19 |
tagggaatttggtttgcatgtgagaatctagtgggtgattggtttggaagaaaacattcactgcactggctggcatttggtgaagtacacgtttctgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512687 |
tagggaatttggtttgcatgtgagaatctagtgggtgattggtttggaagaaaacattcactgcactggctggcatttggtgaagtacacgtttctgaaa |
33512588 |
T |
|
| Q |
119 |
gctcaatggacaaaagtgtttttgacttccaaggaacatcattttgaataatcattatgttggggactcttattcatggctgctccttctcaccaaagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512587 |
gctcaatggacaaaagtgtttttgacttccaaggaacatcattttgaataatcattatgttggggactcttattcatggctgctccttctcaccaaagaa |
33512488 |
T |
|
| Q |
219 |
gaaagatacttttcttcatcttttctctgtagtctttatacatcaatttgaacgtttgttctttcccgcactcatcttacaaca |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33512487 |
gaaagatacttttcttcatcttttctctgtactctttatacatcaatttgaacg-ttgttctttcccgcactcatcttacaaca |
33512405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University