View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9504_low_46 (Length: 313)

Name: NF9504_low_46
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9504_low_46
NF9504_low_46
[»] chr4 (1 HSPs)
chr4 (19-302)||(33512405-33512687)


Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 19 - 302
Target Start/End: Complemental strand, 33512687 - 33512405
Alignment:
19 tagggaatttggtttgcatgtgagaatctagtgggtgattggtttggaagaaaacattcactgcactggctggcatttggtgaagtacacgtttctgaaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33512687 tagggaatttggtttgcatgtgagaatctagtgggtgattggtttggaagaaaacattcactgcactggctggcatttggtgaagtacacgtttctgaaa 33512588  T
119 gctcaatggacaaaagtgtttttgacttccaaggaacatcattttgaataatcattatgttggggactcttattcatggctgctccttctcaccaaagaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33512587 gctcaatggacaaaagtgtttttgacttccaaggaacatcattttgaataatcattatgttggggactcttattcatggctgctccttctcaccaaagaa 33512488  T
219 gaaagatacttttcttcatcttttctctgtagtctttatacatcaatttgaacgtttgttctttcccgcactcatcttacaaca 302  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||    
33512487 gaaagatacttttcttcatcttttctctgtactctttatacatcaatttgaacg-ttgttctttcccgcactcatcttacaaca 33512405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University