View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_48 (Length: 306)
Name: NF9504_low_48
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 35576066 - 35575861
Alignment:
| Q |
1 |
agcttattggaacatgtagtttttaatgttgtttatttatgcttgtgagaatttgagannnnnnnnaatatgattgttttctaaagtttgttagnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35576066 |
agcttattggaacatgtagtttttaatgttgtttatttatgcttgtgagaatttgagattttttttaatatgattgttttctaaagtttgttagtttttt |
35575967 |
T |
 |
| Q |
101 |
nnn-atatgtcaaagtttcttaggtgaattgttttgggtttgttatgattatggattcatagagaaaattgaaacacatgataaagatgagtatgtgtta |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35575966 |
ttttatatgtcaaagtttcttag-tgaattgttttgggtttgttatgattatggattcatagagaaatttgaaacacatgataaagatgagtatgtgtta |
35575868 |
T |
 |
| Q |
200 |
taacatg |
206 |
Q |
| |
|
||||||| |
|
|
| T |
35575867 |
taacatg |
35575861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 206 - 274
Target Start/End: Complemental strand, 35575834 - 35575756
Alignment:
| Q |
206 |
gttattaaccatgtagcatacactttggattgagtgt----------tccaacgcgtgttagtgtcgtgtttgacatgt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35575834 |
gttattaaccatgtagcatacactttggattgagtgtgtgtttagtgtccaacgcgtgttagtgtcgtgtttgacatgt |
35575756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University