View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_54 (Length: 289)
Name: NF9504_low_54
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 32144059 - 32144329
Alignment:
| Q |
18 |
taaatagggtctttgtcaaactttgaatttgtttaggtttgttgagcatttgagaggctctagtgatgaattaatttttcctaaagatgaagcccccttt |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32144059 |
taaatagggtcttggtcaaactttgaatttgtttaggtttgttgagcatttgagaggctctagtgatgaattaatttttcctaaagatgaagcccccttt |
32144158 |
T |
 |
| Q |
118 |
ggtgattgtcttgcattgcatccatcgatgaagacagc------aagaaccaatgcagatggatatgtagtagagcatttggacaagatcacatcctagg |
211 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32144159 |
ggggattgtcttgcattgcatccatcgatgaagacagcttaagaaagaaccaatgcagttggatatgtagtagagcatttggacaagatcacatcctggg |
32144258 |
T |
 |
| Q |
212 |
cataagaaatgaggtatgaatttttaatttgctatcatcattttaatgtatgc-ttttccaacaccaaact |
281 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
32144259 |
cataagaaatgaggtataaatttttaatttgctatcatcattttaatgtatgctttttccaacacctaact |
32144329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University