View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_57 (Length: 281)
Name: NF9504_low_57
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 220 - 265
Target Start/End: Complemental strand, 13153239 - 13153194
Alignment:
| Q |
220 |
aaagtctagctagcattactttcttgttttccaacacacatgatat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13153239 |
aaagtctagctagcattactttcttgttttccaacacacatgatat |
13153194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University