View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9504_low_58 (Length: 281)

Name: NF9504_low_58
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9504_low_58
NF9504_low_58
[»] chr2 (1 HSPs)
chr2 (220-265)||(13153194-13153239)


Alignment Details
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 220 - 265
Target Start/End: Complemental strand, 13153239 - 13153194
Alignment:
220 aaagtctagctagcattactttcttgttttccaacacacatgatat 265  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
13153239 aaagtctagctagcattactttcttgttttccaacacacatgatat 13153194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University