View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_63 (Length: 256)
Name: NF9504_low_63
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 629713 - 629903
Alignment:
| Q |
1 |
tgttgctgatagtttggttgttgatgtaatcactgaggatgttggtgaagttgttaaggttgttgatcatgctcctgttttagctcaacttccaaagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
629713 |
tgttgctgatagtttggttgttgatgtaatcactgaggatgttggtgaagttgttaaggttgttgatcatgctcctgttttagctcaaattccaaagaat |
629812 |
T |
|
| Q |
101 |
gattttcgtaatgatactagattgcaggattttgtggagaaagatatcagcgatcaaagtaattttcttgaactctttttatagtgattgg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629813 |
gattttcgtaatgatactagattgcaggattttgtggagaaagatatcagcgatcaaagtaattttcttgaactctttttatagtgattgg |
629903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 240
Target Start/End: Original strand, 629925 - 629963
Alignment:
| Q |
202 |
gttgaattttgtgtatttgtatattttgttaatggggat |
240 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
629925 |
gttgaattttgtgtatttgtatattgtgttaatggggat |
629963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University