View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_64 (Length: 254)
Name: NF9504_low_64
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 5596088 - 5596227
Alignment:
| Q |
1 |
actcttggcaaaagggtatataaaatcaacaaaaaggagggaactttttgcttgattgatcaagaatcaacaaaagggtatttaaattcaacagaaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5596088 |
actcttggcaaaagggtatataaaatcaacaaaaaggagggaactttttgcttgattgatcaagaatcaacaaaagggtatttaaattcaacagaaagga |
5596187 |
T |
 |
| Q |
101 |
gggaaaagagaaaggttttgggtatttaaaatcaatgaaa |
140 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5596188 |
gggaaaagagagaggttttgggtatttaaaatcaatgaaa |
5596227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 5596271 - 5596323
Alignment:
| Q |
184 |
ataatcggataagatcgtttactttcaggttcccgcttccctatgccctagtg |
236 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
5596271 |
ataatcggataagatcgtatattttcaggttcccgcttccctatgccctagtg |
5596323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University