View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9504_low_75 (Length: 234)
Name: NF9504_low_75
Description: NF9504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9504_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 2 - 217
Target Start/End: Original strand, 31855715 - 31855932
Alignment:
| Q |
2 |
agcagagacatctagaaccttagcatttgtggaccgc--tttagaaatattcatattttactatgattaagttgtaataagtaactaactcttgtgttct |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31855715 |
agcagagacctctagaaccttagcatttgtggaccgcaatttagaaatattcatattttactatgattaagttgtaataagtaactaactcttgtgttct |
31855814 |
T |
 |
| Q |
100 |
caacatggttatagccaaatgaagatgctcaatattcagctctagccaaagttgaactgaaaaagttgtttgcgacaaaaacggtacatatttaacatgt |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31855815 |
caacgtggttatagccaaatgaagatgctcaatattcagctctagccaaagttgaactgaaaaagttgtttgcgacaaaaacggtacatatttaacatgt |
31855914 |
T |
 |
| Q |
200 |
ctttgtgatgtacattat |
217 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
31855915 |
ctttgtgatgtactttat |
31855932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University