View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9506_low_3 (Length: 320)
Name: NF9506_low_3
Description: NF9506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9506_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 49977545 - 49977355
Alignment:
| Q |
16 |
taggtgaagggcagcttgagcaacaaggttgtgatcattacgtaagaggagctgacgagcattgttcaacttctctgtttctttctctgcacccaaacca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49977545 |
taggtgaagggcagcttgagcaacaaggttgtgatcattacgtaagaggagctgacgagcattgttcaacttctctgtttctttctctgcacccaaacca |
49977446 |
T |
|
| Q |
116 |
accacacaacaatcacaaatcaaatcaaaccgaaaaataataaaattattattatatcaaaggttttattgaaatggaatattttcttttg |
206 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49977445 |
accacacaacaataacaaatcaaatcaaaccgaaaaataataaaaatattattatatcaaaggttttattgaaatggaatattttcttttg |
49977355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 257 - 301
Target Start/End: Complemental strand, 49977304 - 49977260
Alignment:
| Q |
257 |
agctagccttggcgatgacggttcatgtgtcccccaagagcctga |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49977304 |
agctagccttggcgatgacggttcatgtgtcccccaagagcctga |
49977260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 257 - 301
Target Start/End: Original strand, 49953468 - 49953512
Alignment:
| Q |
257 |
agctagccttggcgatgacggttcatgtgtcccccaagagcctga |
301 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49953468 |
agctagccttggcggtgacggttcatgtgtcccccaagagcctga |
49953512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University