View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9507_high_10 (Length: 246)

Name: NF9507_high_10
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9507_high_10
NF9507_high_10
[»] chr2 (2 HSPs)
chr2 (19-114)||(19506155-19506250)
chr2 (166-226)||(19506096-19506156)
[»] chr5 (1 HSPs)
chr5 (52-118)||(20568697-20568763)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 19506250 - 19506155
Alignment:
19 aaaattgctaaagcgataaagattacaatcagtttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcg 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
19506250 aaaattgctaaagcgataaagattacaatcagtttttgtccttctgtgcttttatttacgaaaacaaatttagttttcggcatgaattcggtttcg 19506155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 166 - 226
Target Start/End: Complemental strand, 19506156 - 19506096
Alignment:
166 cgtgcgataagcatatggttatgtcggtttcaatttcacgtatcaatatagagtttaagat 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19506156 cgtgcgataagcatatggttatgtcggtttcaatttcacgtatcaatatagagtttaagat 19506096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 52 - 118
Target Start/End: Original strand, 20568697 - 20568763
Alignment:
52 ttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcggcta 118  Q
    |||||| |||||||| ||| ||| ||||||| ||||||||||||| || |||||| |||||||||||    
20568697 ttttgttcttctgtggtttaattcacgaaaataaatttagttttcagcctgaatttggtttcggcta 20568763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University