View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_high_12 (Length: 229)
Name: NF9507_high_12
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 56 - 229
Target Start/End: Complemental strand, 36485647 - 36485475
Alignment:
| Q |
56 |
gatgactcgaaattatttatttattttttgcttggggctttagcccccnnnnnnncaccnnnnnnnnnncctctctctcttaacattgctcaggggcgcc |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
36485647 |
gatgactcgaaattatgtatttattttttgcttgtggctttagccccctttttttcaccaaaaaaaaa-cctatctctcttaacattgctcaggggcgcc |
36485549 |
T |
 |
| Q |
156 |
tcctctatcccattatcactgcaacactttcttctcgctaacatgatgggaaataatactaaaatctctaaact |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36485548 |
tcctctatcccattatcactgcaacactttcttctctctaacatgatgggaaataatactaaaatctctaaact |
36485475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University