View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9507_high_12 (Length: 229)

Name: NF9507_high_12
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9507_high_12
NF9507_high_12
[»] chr4 (1 HSPs)
chr4 (56-229)||(36485475-36485647)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 56 - 229
Target Start/End: Complemental strand, 36485647 - 36485475
Alignment:
56 gatgactcgaaattatttatttattttttgcttggggctttagcccccnnnnnnncaccnnnnnnnnnncctctctctcttaacattgctcaggggcgcc 155  Q
    |||||||||||||||| ||||||||||||||||| |||||||||||||       ||||          ||| |||||||||||||||||||||||||||    
36485647 gatgactcgaaattatgtatttattttttgcttgtggctttagccccctttttttcaccaaaaaaaaa-cctatctctcttaacattgctcaggggcgcc 36485549  T
156 tcctctatcccattatcactgcaacactttcttctcgctaacatgatgggaaataatactaaaatctctaaact 229  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
36485548 tcctctatcccattatcactgcaacactttcttctctctaacatgatgggaaataatactaaaatctctaaact 36485475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University