View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_high_5 (Length: 365)
Name: NF9507_high_5
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 32 - 349
Target Start/End: Complemental strand, 8467858 - 8467541
Alignment:
| Q |
32 |
acaggttctcatcctccatattttgaggtaattgtttcaaactttcaatatagtttcaaactactggttgatttaagcgtatacttatttatttttgtag |
131 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467858 |
acagcttctcatcctccatattttgaggtaattgtttcaaactttcaatatagtttcaaacttctggttgatttaagcgtatacttatttatttttgtag |
8467759 |
T |
 |
| Q |
132 |
atggttaaggaggctttactggctctaaaggagaggaatggctcaagcccttacgctatagcgaaatacatggacgagaagttcaagccggtgctcccag |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467758 |
atggttaaggaggctttactggctctaaaggagaggaatggctcaagcccttacgctatagcgaaatacatggacgagaagttcaagccggtgctcccag |
8467659 |
T |
 |
| Q |
232 |
caaatttcaagaagatactaagcttgcagcttaagaatcaaaccaagagagggaagctggtgaagatcaaagcttcgtataaactatctgatgccgagaa |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467658 |
caaatttcaagaagatactaagcttgcagcttaagaatcaaaccaagagagggaagctggtgaagatcaaagcttcgtataaactatctgatgccgagaa |
8467559 |
T |
 |
| Q |
332 |
gccgaagaaggagaaaaa |
349 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8467558 |
gccgaagaaggagaaaaa |
8467541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 8467865 - 8467902
Alignment:
| Q |
1 |
ttgtttggaagcttttggtttcatttccttcacaggtt |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467865 |
ttgtttggaagcttttggtttcatttccttcacaggtt |
8467902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University