View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_high_6 (Length: 365)
Name: NF9507_high_6
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 349
Target Start/End: Complemental strand, 8467889 - 8467541
Alignment:
| Q |
1 |
aatgaaaccaaaagcttccaaacaaaccaaaacagcttctcatcctccatattttgaggtaattgtttcaaactttcaatatagtttcaaactactggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8467889 |
aatgaaaccaaaagcttccaaacaaaccaaaacagcttctcatcctccatattttgaggtaattgtttcaaactttcaatatagtttcaaacttctggtt |
8467790 |
T |
 |
| Q |
101 |
gatttaagcgtatacttatttatttttgtagatggttaaggaggctttactggctctaaaggagaggaatggctcaagcccttacgctatagcgaaatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467789 |
gatttaagcgtatacttatttatttttgtagatggttaaggaggctttactggctctaaaggagaggaatggctcaagcccttacgctatagcgaaatac |
8467690 |
T |
 |
| Q |
201 |
atggacgagaagttcaagccggtgctcccagcaaatttcaagaagatactaagcttgcagcttaagaatcaaaccaagagagggaagctggtgaagatca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467689 |
atggacgagaagttcaagccggtgctcccagcaaatttcaagaagatactaagcttgcagcttaagaatcaaaccaagagagggaagctggtgaagatca |
8467590 |
T |
 |
| Q |
301 |
aagcttcgtataaactatctgatgccgagaagccgaagaaggagaaaaa |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467589 |
aagcttcgtataaactatctgatgccgagaagccgaagaaggagaaaaa |
8467541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University