View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_high_9 (Length: 250)
Name: NF9507_high_9
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 28341673 - 28341420
Alignment:
| Q |
1 |
attgaactccacaggaacaaaacgaaccgggaggtgcttcttgaaccggatcctcagcagcagcaggttc------------atcagtaactaacgaaat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28341673 |
attgaactccacaggaacaaaacgaaccaggaggagcttctggaaccggatcctcagcagcagcaggttcttcagcaggttcatcagtaactaacgaaat |
28341574 |
T |
 |
| Q |
89 |
cactttctcagcgttttcttcagggcaaacttcaacatcgccgttttctccgtcaacttttgcttcctgttcatccttcacagattccaccttctgaatt |
188 |
Q |
| |
|
||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28341573 |
cactttctctgcgttttcttcggggtaaacttcaacatcgccgttttctccgtcaactttcacttcctgttcatccatcacagattccaccttctgaatt |
28341474 |
T |
 |
| Q |
189 |
tcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341473 |
tcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgct |
28341420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 125
Target Start/End: Original strand, 28382066 - 28382177
Alignment:
| Q |
11 |
acaggaacaaaacgaaccgggaggtgcttcttgaaccggatcctcagcagcagcaggttcatcagtaactaacgaaatcactttctcagcgttttcttca |
110 |
Q |
| |
|
|||||||||| | |||||||| | |||||||||||||||||||||||| || ||||| ||||||||||| ||||||| | || |||||||||||| |
|
|
| T |
28382066 |
acaggaacaatatgaaccgggttgaacttcttgaaccggatcctcagcagaag---gttcactagtaactaacggaatcactctttccgcgttttcttca |
28382162 |
T |
 |
| Q |
111 |
gggcaaacttcaaca |
125 |
Q |
| |
|
| | |||| |||||| |
|
|
| T |
28382163 |
gaggaaacatcaaca |
28382177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University