View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_low_18 (Length: 333)
Name: NF9507_low_18
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 31439232 - 31439549
Alignment:
| Q |
1 |
gattgcagagcaagcaatatcttcaataagaactgttttctcttatgttggggagaatcaaacactaaaaagatttagcactgcacttgaaaaaactatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439232 |
gattgcagagcaagcaatatcttcaataagaactgttttctcttatgttggggagaatcaaacactaaaaagatttagcactgcacttgaaaaaactatg |
31439331 |
T |
 |
| Q |
101 |
gagtttggaataaagcaaggttttgcaaaagggttgatgttaggaagtatgggagttatttatgtaagttggggttttcaagcttgggttggaacttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439332 |
gagtttggaataaagcaaggttttgcaaaagggttgatgttaggaagtatgggagttatttatgtaagttggggttttcaagcttgggttggaacttttt |
31439431 |
T |
 |
| Q |
201 |
tgatatccgataaaggagagaaaggtggccatgtatttgtagctggctttaacattttaatgggaggactgtaagtgattttatcattacttatattcta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439432 |
tgatatccgataaaggagagaaaggtggccatgtatttgtagctggctttaacatcttaatgggaggactgtaagtgattttatcattacttatattcta |
31439531 |
T |
 |
| Q |
301 |
gttttataatcacttttt |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31439532 |
gttttataatcacttttt |
31439549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University