View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_low_23 (Length: 258)
Name: NF9507_low_23
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 31697826 - 31698060
Alignment:
| Q |
16 |
tatgaaaagtgcaatttgcttcaaatatcagatctcgaaggttattcttttgaagaccaatgtgaagagattccgagataaaacgtgaagtcttttcaag |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31697826 |
tatgaaaagtgcaatttgcgtcaaatatcagatctcgaaggttattcttttgaagaccaatgtgaagagattccgagatacaacgtgaagtcttttcaag |
31697925 |
T |
 |
| Q |
116 |
caaaggttgatcgttgttcaacattcaaaattcagtgtaataagaagcttgaaagactccaacaaagttagaagacacttaacattcatgcattgcagga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31697926 |
caaaggttgatcgttgttcaacattcaaaattcagtgtaataagaagcttgaaagactccaacaaagttagaagacacttaacattcatgcattgcagga |
31698025 |
T |
 |
| Q |
216 |
gttagtttattttctcttaagtaaacagtataatc |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31698026 |
gttggtttattttctcttaagtaaacagtataatc |
31698060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University