View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_low_26 (Length: 246)
Name: NF9507_low_26
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 19506250 - 19506155
Alignment:
| Q |
19 |
aaaattgctaaagcgataaagattacaatcagtttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506250 |
aaaattgctaaagcgataaagattacaatcagtttttgtccttctgtgcttttatttacgaaaacaaatttagttttcggcatgaattcggtttcg |
19506155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 166 - 226
Target Start/End: Complemental strand, 19506156 - 19506096
Alignment:
| Q |
166 |
cgtgcgataagcatatggttatgtcggtttcaatttcacgtatcaatatagagtttaagat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19506156 |
cgtgcgataagcatatggttatgtcggtttcaatttcacgtatcaatatagagtttaagat |
19506096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 52 - 118
Target Start/End: Original strand, 20568697 - 20568763
Alignment:
| Q |
52 |
ttttgtccttctgtgctttcatttacgaaaacaaatttagttttcggcatgaattcggtttcggcta |
118 |
Q |
| |
|
|||||| |||||||| ||| ||| ||||||| ||||||||||||| || |||||| ||||||||||| |
|
|
| T |
20568697 |
ttttgttcttctgtggtttaattcacgaaaataaatttagttttcagcctgaatttggtttcggcta |
20568763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University