View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9507_low_29 (Length: 241)

Name: NF9507_low_29
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9507_low_29
NF9507_low_29
[»] chr5 (2 HSPs)
chr5 (18-241)||(28341680-28341903)
chr5 (42-227)||(28381865-28382053)


Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 28341903 - 28341680
Alignment:
18 atcaacctcattgacaacaggcacatacgcaaaataaaccggttcaccagttggtccggttaccggcctcattgcttggtacaatcctgaagatgttgga 117  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
28341903 atcaacctcattgacaacaggcacatacgcgaaataaaccggttcaccaattggtccggttaccggcctcattgcttggtacaatcctgaagatgttgga 28341804  T
118 atcaaataaaccggtaacagttcagttgaataccccatcgagtaataaccatcagcagccaaattgtgcatttctggagtaaatgatgactgaaccgaaa 217  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
28341803 atcaaataaaccggtaacagttcagttgaataccccgtcgagtaataaccatcagcagccaaattgtgcatttctggagtaaatgatgactgaactgaaa 28341704  T
218 ccggttcaggaaccaaacccggtt 241  Q
     |||||||||||||||||||||||    
28341703 gcggttcaggaaccaaacccggtt 28341680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 42 - 227
Target Start/End: Original strand, 28381865 - 28382053
Alignment:
42 atacgcaaaataaaccggttcaccagttggtccggttaccggcctcattgcttggtacaatcctgaagatgttggaatcaaataaaccggtaacagttca 141  Q
    |||||||||||||||||||| |||||||||||| || | ||||||||| ||||| |||||||| |||| ||||||||||||||||||||||||| |||||    
28381865 atacgcaaaataaaccggttgaccagttggtccagtaatcggcctcatagcttgatacaatccagaaggtgttggaatcaaataaaccggtaacggttca 28381964  T
142 gttgaataccccatcgagta---ataaccatcagcagccaaattgtgcatttctggagtaaatgatgactgaaccgaaaccggttcagg 227  Q
     ||  |||||||||||| ||   |  |||| || |||| | ||| | |||||||| || ||| ||||||||||||||||||||||||||    
28381965 tttacataccccatcgaataaccagcaccagcaacagcaacattatacatttctgaagcaaaggatgactgaaccgaaaccggttcagg 28382053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University