View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9507_low_29 (Length: 241)
Name: NF9507_low_29
Description: NF9507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9507_low_29 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 28341903 - 28341680
Alignment:
| Q |
18 |
atcaacctcattgacaacaggcacatacgcaaaataaaccggttcaccagttggtccggttaccggcctcattgcttggtacaatcctgaagatgttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341903 |
atcaacctcattgacaacaggcacatacgcgaaataaaccggttcaccaattggtccggttaccggcctcattgcttggtacaatcctgaagatgttgga |
28341804 |
T |
 |
| Q |
118 |
atcaaataaaccggtaacagttcagttgaataccccatcgagtaataaccatcagcagccaaattgtgcatttctggagtaaatgatgactgaaccgaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28341803 |
atcaaataaaccggtaacagttcagttgaataccccgtcgagtaataaccatcagcagccaaattgtgcatttctggagtaaatgatgactgaactgaaa |
28341704 |
T |
 |
| Q |
218 |
ccggttcaggaaccaaacccggtt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28341703 |
gcggttcaggaaccaaacccggtt |
28341680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 42 - 227
Target Start/End: Original strand, 28381865 - 28382053
Alignment:
| Q |
42 |
atacgcaaaataaaccggttcaccagttggtccggttaccggcctcattgcttggtacaatcctgaagatgttggaatcaaataaaccggtaacagttca |
141 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| || | ||||||||| ||||| |||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
28381865 |
atacgcaaaataaaccggttgaccagttggtccagtaatcggcctcatagcttgatacaatccagaaggtgttggaatcaaataaaccggtaacggttca |
28381964 |
T |
 |
| Q |
142 |
gttgaataccccatcgagta---ataaccatcagcagccaaattgtgcatttctggagtaaatgatgactgaaccgaaaccggttcagg |
227 |
Q |
| |
|
|| |||||||||||| || | |||| || |||| | ||| | |||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
28381965 |
tttacataccccatcgaataaccagcaccagcaacagcaacattatacatttctgaagcaaaggatgactgaaccgaaaccggttcagg |
28382053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University