View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9511_low_11 (Length: 216)

Name: NF9511_low_11
Description: NF9511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9511_low_11
NF9511_low_11
[»] chr2 (1 HSPs)
chr2 (19-205)||(10757366-10757552)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 10757552 - 10757366
Alignment:
19 aagcatacacagactgtggacacgacactgacactaatacgtcaacaccggtactgatttgataaatggaagcgattgaatgtaatcatatgtatcagtg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||    
10757552 aagcatacacagactgtggacacgacactgacactaatacgtcaacaccggtaatgatttgataaatggaagcgattgaatataatcatatgcatcagtg 10757453  T
119 ttgttgctacatagattttggttgtgttgaaaataaagagagcatgtcataataatctattttgctcaaatctgtttgaacaccaaa 205  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10757452 ttgttgctccatagattttggttgtgttgaaaataaagagagcatgtcataataatctattttgctcaaatctgtttgaacaccaaa 10757366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University