View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9513_low_14 (Length: 204)
Name: NF9513_low_14
Description: NF9513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9513_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 14984842 - 14985031
Alignment:
| Q |
1 |
agagtggctgaactgtaatgatgttcgaggctcacaatannnnnnngtacaattctgtggaaagtctggtatgctaggaatcaggctgtgtttaatagta |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14984842 |
agagtggctgaactgtaatgatgtttgaggctcacaat--ttttttgtacaattctgtggaaagtctggtatgctaggaatcaggctgtgtttaatggta |
14984939 |
T |
|
| Q |
101 |
ctccaacagacccaattagattggctcagtctgcagtgcagtttgtgcaggaacacgttgcagcaaacgcaaaattaagacccacacaggtt |
192 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14984940 |
ctccaacagacccaatcagattggctcagtctgcagtgcagtttgtgcaggaacacgttgcagcaaacgcaaaattaagacccacacaggtt |
14985031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University