View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9516_low_8 (Length: 216)
Name: NF9516_low_8
Description: NF9516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9516_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 198
Target Start/End: Original strand, 30222196 - 30222381
Alignment:
| Q |
13 |
agagagaagagtgagagatgggaagaggtgagaagggttggttgagttggggggtttgaaaagttgtttcgtggtgaagaagtaactttttgagaggttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30222196 |
agagagaagagtgagagatgggaagaggtgagaagggttggttgagttggggggtttgaaaagttgtttcgtggtgaagaagtaactttttgagaggttt |
30222295 |
T |
|
| Q |
113 |
ctaaacaaagacatggttagtgtgtttgtgtttgagatgttgaagaaagaagaaatgaagttccaaagatgtagactgatgggatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30222296 |
ctaaacaaagacatggttagtgtgtttgtgtttgagatgttgaagaaagaagaaatgaagttccaaagatgtagactgatgggatg |
30222381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University