View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9518_2 (Length: 870)
Name: NF9518_2
Description: NF9518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9518_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 1e-92
Query Start/End: Original strand, 604 - 853
Target Start/End: Complemental strand, 33573177 - 33572930
Alignment:
| Q |
604 |
ttattacggagttggtggaacaagtagtgtt-ataattttaaggttcagaagtatcaatcaagtgaagctatgttatggattcaaaatggacctacatat |
702 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
33573177 |
ttattacggagttggtggaacaagtagtgtttataattttaaggttcagaagtatcaatcaagtgaagctatgttatggattcaaaatggac---cagat |
33573081 |
T |
|
| Q |
703 |
agaccagatttgattggaattggatggcatgtgagtttcatattgttgatttatatttaa-nnnnnnnatcataaaatatggttttcacacaaaaaatta |
801 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33573080 |
agaccagatttgattggaatt-gatggcatgtgagtttcatattgttgatttatatttaattttttttatcataaaatatggttttcacacaaaaaatta |
33572982 |
T |
|
| Q |
802 |
attatttatgatttgtcaatttaggtggatccaaaactatacaatgatgatg |
853 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| ||||||| |
|
|
| T |
33572981 |
tttatttatgatttgtcaatttaagtggctccaaaactatacaacgatgatg |
33572930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University